Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1493
hypothetical protein

Plasmid ID: PC011493-42
Plasmid Vector: pET-21a(+)
Description:  
Constructed: 08/24/2012
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHITATGGATCCTTATTAGAGGGGGTCGTCCTGGAGGACGAGG
1FwNdeIATACATATGTTGGGGCCTGTGCTGAGGCTT

DNA sequence: AA Sequence:
 Length: 385
M.W.: 43568.58
Met: 4
database record last modified: 08/30/2012