Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1269
transposase

Plasmid ID: PC011269-43
Plasmid Vector: pET-HisTEV
Description:  
Constructed: 10/18/2006
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTAAGAGTTATGTGTAAGAGTCTGTGTACGGGG
1FwNdeIATATCATATGTTTAATAGGGGGGCACACCTTAGCACG

DNA sequence: AA Sequence:
 Length: 427
M.W.: 49132.2
Met: 5
database record last modified: 08/24/2012