Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0656
ribosomal protein L11 methyltransferase

Plasmid ID: PC010656-42
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 08-A-09
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvSalIatatgtcgacttattacctcccgtaggcgaggaggacccac
1FwNdeIatatcatatgtgggtttaccggcttaagggcaccctcg

DNA sequence: AA Sequence:
 Length: 254
M.W.: 27634.37
Met: 4
database record last modified: 07/27/2010