Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1642
S-adenosylmethionine synthetase

Plasmid ID: PC011642-42
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattaaagccccgcttcccgcctcaaggcc
1FwNdeIatatcatatgcgtgcgttgaggctggtcacgtctgaat

DNA sequence: AA Sequence:
 Length: 395
M.W.: 43252.87
Met: 5
database record last modified: 07/27/2010