Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1543
hypothetical protein

Plasmid ID: PC011543-41
Plasmid Vector: pET-11a
Description:  
Constructed: 05/31/2004
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 15-G-12
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTAGAAGCGGTAGCCCACCTTGAACTGG
1FwNdeIATATCATATGCGTAAGCTTTTGGCGACCGC

DNA sequence: AA Sequence:
 Length: 146
M.W.: 15310.78
Met: 1
database record last modified: 06/24/2010