Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHB158
hypothetical protein

Plasmid ID: PC014158-41
Plasmid Vector: pET-11a
Description:  
Constructed: 04/01/1904
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 16-F-12
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTAAGGGCGAGGCTCAGGAGCCAG
1FwNdeIATATCATATGTTGAACGGCTTCAGGGTGTTGC

DNA sequence: AA Sequence:
 Length: 321
M.W.: 36796.27
Met: 7
database record last modified: 06/24/2010