Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1136
ba3-type cytochrome c oxidase subumit X, CbaX

Plasmid ID: PC011136-41
Plasmid Vector: pET-11a
Description:  
Constructed: 04/01/1904
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 16-E-09
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTACGGCCGGGCCCTCCAGAG
1FwNdeIATATCATATGTTGCTCGCCCGCGCCTA

DNA sequence: AA Sequence:
 Length: 156
M.W.: 16873.28
Met: 3
database record last modified: 06/24/2010