Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1361
hypothetical protein

Plasmid ID: PC011361-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 13-G-06
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTATGGCCAAAGCCTCCCCGG
1FwNdeIATATCATATGAAACGCCGCCTCGTCCTC

DNA sequence: AA Sequence:
 Length: 121
M.W.: 12957.33
Met: 1
database record last modified: 06/24/2010