Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0213
hypothetical protein

Plasmid ID: PC010213-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 17-B-02
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTAAGGGCAGGGCGTGGAGGAGA
1FwNdeIATATCATATGTGGCGGATTATGGCCCTG

DNA sequence: AA Sequence:
 Length: 265
M.W.: 27835.35
Met: 2
database record last modified: 06/24/2010