Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHC005
hypothetical protein

Plasmid ID: PC016005-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 17-A-06
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTATCGGTACGCCCAGTACCAGCG
1FwNdeIATATCATATGCGTAAGCTCGTCGGCCTTG

DNA sequence: AA Sequence:
 Length: 158
M.W.: 17419.18
Met: 1
database record last modified: 06/24/2010