Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0347
O-acetylserine (thiol)-lyase (cysteine synthase)

Plasmid ID: PC010347-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 14-B-02
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIATATAGATCTTTATTAGGGCTCGGCGTAAAGGGGGGTGGAG
1FwNdeIATATCATATGCGTGTGGAGGGCGCCATCG

DNA sequence: AA Sequence:
 Length: 304
M.W.: 33029.43
Met: 11
database record last modified: 06/24/2010