Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1269
transposase

Plasmid ID: PC011269-42
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 13-C-07
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIATATGGATCCTTATTAAGAGTTATGTGTAAGAGTCTGTGTACGGGG
1FwNdeIATATCATATGTTTAATAGGGGGGCACACCTTAGCACG

DNA sequence: AA Sequence:
 Length: 406
M.W.: 46726.35
Met: 4
database record last modified: 06/24/2010