Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1367
hypothetical protein

Plasmid ID: PC011367-42
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 05-E-05
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIatatagatctttattactccaggacgaccaccacgagcctc
1FwNdeIatatcatatggaagctaggaccaggatcctcgcccggg

DNA sequence: AA Sequence:
 Length: 187
M.W.: 20279.03
Met: 2
database record last modified: 07/27/2010