Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0508
transcriptional regulator, MerR family

Plasmid ID: PC010508-42
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 07-D-01
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattagcccccgcccaaggcctcctccttc
1FwNdeIatatcatatggacaaggtggtggacaaggaccgccccg

DNA sequence: AA Sequence:
 Length: 233
M.W.: 26874.44
Met: 5
database record last modified: 07/27/2010