Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0654
ATP-binding protein, Mrp/Nbp35 family

Plasmid ID: PC010654-42
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 04-H-12
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvSalIatatgtcgacttattaggccatggggagggggaggaaggtc
1FwNdeIatatcatatggctcttacggaagagcgggtcctcgagg

DNA sequence: AA Sequence:
 Length: 350
M.W.: 37267.32
Met: 8
database record last modified: 07/27/2010