Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1969
chromosome partitioning protein, ParB family

Plasmid ID: PC011969-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattacgcctggtagccgaggcgccgcaga
1FwNdeIatatcatatgagcaggaagcctagcggtctcgggcggg

DNA sequence: AA Sequence:
 Length: 269
M.W.: 29764.32
Met: 5
database record last modified: 07/27/2010