Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0606
aspartate 1-decarboxylase

Plasmid ID: PC010606-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 03-E-09
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvSalIatatgtcgacttattatcctttgcgcacctcgaggatccgg
1FwNdeIatatcatatgaaaagggtgatgttccacgccaagatcc

DNA sequence: AA Sequence:
 Length: 120
M.W.: 13096.72
Met: 2
database record last modified: 07/27/2010