Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1367
hypothetical protein

Plasmid ID: PC011367-41
Plasmid Vector: pET-11a
Description: E133K
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIatatagatctttattactccaggacgaccaccacgagcctc
1FwNdeIatatcatatggaagctaggaccaggatcctcgcccggg

DNA sequence: AA Sequence:
 Length: 187
M.W.: 20278.09
Met: 2
database record last modified: 06/24/2010