Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1448
4-hydroxybutyrate CoA-transferase

Plasmid ID: PC011448-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 01-E-06
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattacggcctcccgcgcttttcctccagc
1FwNdeIatatcatatgagctaccgcaagaagctcacctcccccg

DNA sequence: AA Sequence:
 Length: 444
M.W.: 48357.01
Met: 10
database record last modified: 07/27/2010