Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1515
phosphoribosylaminoimidazole-succinocarboxamide synthase

Plasmid ID: PC011515-41
Plasmid Vector: pET-11a
Description: E58G,G124V
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattaccccaggacccgccggagcacctcc
1FwNdeIatatcatatggaaaagctctacgagggcaaggccaagg

DNA sequence: AA Sequence:
 Length: 229
M.W.: 25731.01
Met: 4
database record last modified: 06/24/2010