Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0812
phosphoribosylamine-glycine ligase, PurD

Plasmid ID: PC010812-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 02-C-05
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvXhoIatatctcgagttattaggtactgagccgggcgagggccctt
1FwNdeIatatcatatgaaagtcctcgtggtgggcagcggggggc

DNA sequence: AA Sequence:
 Length: 417
M.W.: 44468.13
Met: 8
database record last modified: 07/27/2010