Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1150
DNA polymerase beta family (X family)

Plasmid ID: PC011150-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 01-H-07
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvSalIatatgtcgacttattaaacgcctcgccgggctttgagccag
1FwNdeIatatcatatgcgtaaccaggagctcgcccggatctttg

DNA sequence: AA Sequence:
 Length: 575
M.W.: 64117.54
Met: 9
database record last modified: 07/27/2010