Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0950
DegV family protein

Plasmid ID: PC010950-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 03-D-12
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIatatagatctttattacctcctgggcccggcgaaggccgcc
1FwNdeIatatcatatggctttcgtggccgactccaccctcggcc

DNA sequence: AA Sequence:
 Length: 274
M.W.: 29696.19
Met: 1
database record last modified: 07/27/2010