Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0255
ferric uptake regulation protein

Plasmid ID: PC010255-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIatatagatctttattacctctggcagttcgggcacttcccc
1FwNdeIatatcatatgccaaggaccaaggagaaggaaagctacc

DNA sequence: AA Sequence:
 Length: 147
M.W.: 16991.62
Met: 2
database record last modified: 07/27/2010