Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHB054
precorrin-2 methylase

Plasmid ID: PC014054-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 01-E-02
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattatccttcccctccttttcgccaaagc
1FwNdeIatatcatatgaaactctacctgatcggcctgggccccg

DNA sequence: AA Sequence:
 Length: 223
M.W.: 24141.16
Met: 2
database record last modified: 07/27/2010