Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0654
ATP-binding protein, Mrp/Nbp35 family

Plasmid ID: PC010654-41
Plasmid Vector: pET-11a
Description: D203G
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIatatagatctttattaggccatggggagggggaggaaggtc
1FwNdeIatatcatatggctcttacggaagagcgggtcctcgagg

DNA sequence: AA Sequence:
 Length: 350
M.W.: 37209.29
Met: 8
database record last modified: 06/24/2010