Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0656
ribosomal protein L11 methyltransferase

Plasmid ID: PC010656-41
Plasmid Vector: pET-11a
Description: P225S
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBglIIatatagatctttattacctcccgtaggcgaggaggacccac
1FwNdeIatatcatatgtgggtttaccggcttaagggcaccctcg

DNA sequence: AA Sequence:
 Length: 254
M.W.: 27624.33
Met: 4
database record last modified: 06/24/2010