Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0926
dephospho-CoA kinase (dephosphocoenzyme A kinase)

Plasmid ID: PC010926-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattagcctcgcccttctgtggcccccccg
1FwNdeIatatcatatggggcacgaggcgaagcaccccattatta

DNA sequence: AA Sequence:
 Length: 203
M.W.: 22637.98
Met: 4
database record last modified: 06/24/2010