Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA1427
UvrD protein

Plasmid ID: PC011427-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 02-H-04
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvSalIatatgtcgacttattatgccggcttaagctccgcgtacttg
1FwNdeIatatcatatgagcgacgccctcctagcccccctcaacg

DNA sequence: AA Sequence:
 Length: 692
M.W.: 77733.36
Met: 4
database record last modified: 07/27/2010