Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHB149
CRISPR-associated protein Csm3

Plasmid ID: PC014149-41
Plasmid Vector: pET-11a
Description:  
Constructed:  
Distribution from DNA BANK : available
DNA BANK Plate-Row-Column: 01-A-02
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattaaaggaccacttcctccaccttgagc
1FwNdeIatatcatatgaaactcaagaaggtgatccgcatccgct

DNA sequence: AA Sequence:
 Length: 241
M.W.: 27384.78
Met: 4
database record last modified: 07/27/2010