Whole Cell Project Database -Plasmid Vector-

Show All

List View


Thermus thermophilus HB8  TTHA0244
single-stranded DNA binding protein

Plasmid ID: PC010244-41
Plasmid Vector: pET-11a
Description: F255P
Constructed:  
Distribution from DNA BANK : not available
DNA BANK Plate-Row-Column:  
PCR Primer:
Frag. No.:Direction:Enzyme:Sequence:
1RvBamHIatatggatccttattaaaacggcaactcctcttccggcgga
1FwNdeIatatcatatggctcgaggcctgaaccgcgttttcctaa

DNA sequence: AA Sequence:
 Length: 263
M.W.: 29836.06
Met: 4
database record last modified: 06/24/2010